jonesmadison52 jonesmadison52

03-04-2018
Arts

contestada

20. Jazz style is another name for which design movement? (1 point)
A.Art deco
B.art nouveau
C.bauhaus
D.doo-wop

Respuesta :

alvarakaleb12 alvarakaleb12

03-04-2018

Your answer is C. Bauhaus

Hope this helps:)

Answer Link

03-04-2018

Hi there,

Jazz style is another name for C. Bauhaus.~

Answer Link

Otras preguntas

This number line models the division problem 13÷6 . What is the quotient?

If the m<2 = 58° and the m<13 = 111°, find the measures of angles 1, 5, 8, 14, 18. Note: x || m and z || y

A medical company tested a new drug on 100 people for possible side effects. This table shows the results. Side effects No side effects Total Adults 7 43 50 Chi

1. John has a large collection of marbles. You take a random sample of 100 marbles from his collection, and the sample has 40 red marbles, a proportion of 0.4 o

In the space below, write a full narrative description of an event in your memory; you may write a prose piece or a poem. A prose piece must be at least 300 wor

We studied a lot for the test. We still failed

6/7 equals 18 over Y +15 Y= 3 Y=13 Y= 6 Y= 3.2

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

What is the speed of a wave if it has a wavelength of 12 m and a frequency of 3 hertz?

in your opinion about innovation, describe it