104170angel 104170angel

11-12-2022
Biology

contestada

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated DNA strand) GTAGTAGTAGGAGTAGTAGTA. What type of mutation is illustrated? A insertion B Translocation C Substitution D Deletion

Respuesta :

Otras preguntas

what is the first thing that happens when a new cell is produced

Why does Imamu run away in the disappearance by Rosa Guy

simplify completely 12x+36 ÷x^2-4x-21

Which equation is true when m = 4? A.8 ÷ m + 5 = 7 B.4 + 8 ÷ m = 3 C.12 ÷ m + 2 = 2

Boxes of sticky hands popsicles are 4.50. The supermarket is offering a 30% off coupon. What is the price with the coupon? P.S, this is about proportional relat

Please help me !!! ( the directions are at the top of the picture ) Answer what you can correctly for a brainliest and also get a thanks ! Don't answer if you d

41>6m-7 HALLPP PLS IDK WHAT THIS

The force of gravity on an object is known as its mass. t or f

I need help!!! Can someone solve this for me!!!

Lilly takes a train each day to work that averages 35 miles per hour. On her way home, her train ride follows the same path and averages 45 miles per hour. If t