smumford774 smumford774

15-01-2022
History

contestada

select a piece of Civil Rights legislation and write an essay describing its impact on the Civil Rights movement and modern America.
{edmentum]
topic: civil rights movement

Respuesta :

15-01-2022

Answer:

Check screenshot

Explanation:

Ver imagen Jogna

Answer Link

Otras preguntas

where do I put them?

Question Down below.

Can you help me plz i learning it today

please help me please help help help

Assume you could either open a lemonade stand near a college campus and sell 80 cups of lemonade for $.50 per cup in one day or open a stand selling brownies an

Which of the following is a correctly formatted indirect quotation? A. Andrew Jackson believed anyone who couldn’t spell a word more than two ways lacked imagin

18 gram of sucrose is dissolved in 180 gram of water. Calculate the number of oxygen atoms in the solution.answer: 6.684×10^24

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

15w2+62w+63=0 Can you help me

In which country do the people eat fish and seaweed using chopsticks?1 Greece2 India3 Japani pretty sure its 3