cheyyy5 cheyyy5
  • 14-01-2021
  • Biology
contestada

1-5 For the following DNA sequences, replicate the DNA
1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Respuesta :

angelomontoya
angelomontoya angelomontoya
  • 14-01-2021

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

Answer Link

Otras preguntas

In the nuclear transmutation represented by 23994pu(42he, 10n)?, what is the product?
In units of light-years, what is the approximate diameter of our solar system, including the outer reaches of the oort cloud? (assume that 1 light-year equals 6
What is the creation of shared meanings and definitions that motivate and justify collective action?
Describe the history of the us being known as a country that promotes the free exercise of religion
Which composer composed many violin concertos for the girls at the school where he taught and was nick-named "the red priest?"?
One of the most important style choices that a speaker makes is deciding upon the _____ in the speech.
# 14. Q. find the area of rectangle
Which is greater 1.8 or 0.888
Explain why natural selection does not operate on characteristics which affect fitness
what does the first N stand for in the acronym NINJA