gigi1234164 gigi1234164
  • 04-08-2021
  • Mathematics
contestada

To find the missing value?

To find the missing value class=

Respuesta :

syedamaimuna9a6
syedamaimuna9a6 syedamaimuna9a6
  • 04-08-2021

Answer:

To fine the missing value JUST transpose

___ -(-5) = -7       {- * - = +}

___ +5 = -7

___ = -7-5

___= -12

so the missing place is -12

Answer Link
stephanienh12342006 stephanienh12342006
  • 04-08-2021

Answer:

-12

Step-by-step explanation:

Answer Link

Otras preguntas

Help im taking quiz i need help
the verb in Samuel and i
what kinds of social rules have to be improved?write with examples​
Nebi has already typed 250 words. He then starts a timer and finds that he types 150 words in 3 minutes. If nebi types at a constant rate, write a linear equati
What is a theme in "Law of the Jungle"? Family is important. Evil should be feared. Forgiveness is powerful. Revenge can be dangerous. Question 2 Part B Which e
What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
Write the following equation in point-slope form. y=6x+25
PLEASE HELP!!!! The state of Texas did a random sample of the weight of 15 year old boys. The 10 boys they sampled had a total weight of 1250 pounds. What is th
En una bolsa se colocan 8 bolas rojas, 3 blancas y cuatro negras. Se elige una bola al azar y luego sin reposición, se elige otra. ¿calcular la probabilidad de
How did the cotton gin affect the lives of slaves in south carolina?