ricorico01 ricorico01

11-11-2020
Biology

contestada

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Respuesta :

stefftagalilong stefftagalilong

19-11-2020

Answer:

what I don't understand what is the Ctcagt

Answer Link

Otras preguntas

If two angles of a triangle are acute then what is the third angle

A park ranger is shining a spotlight to try to count wildlife at night. Shestarts with a beam that has an angle of 45°. She then increases the angleof the beam

What was the historical significance of Barack Obama’s election in 2008? A. He was the first Democrat elected president in 40 years. B. He was the first Afric

How many neutrons are in an atom of oxygen with a mass number of 18? A. 8 B. 9 C. 10 D. 11

1 in how many women will experience stalking in their lifetime?

Last year, a construction worker had a gross income of $29,700, of which he contributed 7% to his 401(k) plan. If he got paid monthly, how much was deducted fro

Obesity is the second leading cause of preventable _in the United States

20 grams of water. She poured out 15 grams. Which of the following physical properties of the water changes? A .Boiling point B. Density C .Electrical conduct

What is the solution for the inequality -4(x+3)<-2-2x?

does pretroleum jelly help your hair grow