emmanueljackson88 emmanueljackson88

02-05-2021
Health

contestada

The small intestine connects the mouth to the large intestine

Respuesta :

ralbuhasan ralbuhasan

02-05-2021

Answer:

Blinks in disbelief*

Explanation:

Also, you didn't add what you wanted us to do with that question

Answer Link

Otras preguntas

During cellular respiration, which of the following is equal to the total number of carbon, hydrogen, and oxygen atoms in water and carbon dioxide? Number of c

An airplane's change in altitude before landing is shown in the table. What equation represents this change in altitude?

What Are The Character Traits Of John Wick (Keanu Reeves)?

Which of the following statements is true? It was against the law for masters to beat their apprentices. Few states passed black codes that required people to

¿Cómo se llama la amiga de Carlos?

I need help if you can help me thank you.....

Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG

Which triangle could be drown as it is described? DUE TONIGHT HELP PLZZZZZZ!!!!

HElp THIS IS hard please!

Put these numbers in order, smallest to largest. 0.59 0.509 0.5 0.9 5.9