sophiafriend34 sophiafriend34

15-05-2020
Biology

contestada

Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74 queenb74

15-05-2020

The answer is DNA I know because I know

Answer Link

savitar0291 savitar0291

15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

In "Mother to Son," how does Langston Hughes use the image of a person climbing a broken staircase? A. as an allusion to a famous fairy tale about a princess wh

How did reconstruction affect daily life in South Carolina.

what is 1430÷75 in fraction form

A substance with ph of 6 is called? A. acid b. a base. c. water. d. a suspension

AP US History question: Discuss the effects of New Deal reform legislation by examining TWO of the following acts: Social Security Act, Wagner Act, Fair Labor S

How did the Sherman Antitrust Act restrict monopolies?

Submerged basaltic volcanoes that are higher than 1 km are called A. guyots. B. hydrothermal vents. C. seamounts. D. abyssal plains.

There are seven major levels of classification. Kingdom and Phylum are just two of the levels. Which of the following are also major levels of classification? C

Which pair correctly uses a hyphen? (5 points) Anti-American Child-like Semi-final Semi-circle

Turn 0.46 into a fraction