cupcakesrollme cupcakesrollme

13-01-2021
Spanish

contestada

14 through 24 please I really need help will mark brainliest

14 through 24 please I really need help will mark brainliest class=

Respuesta :

JiLeLe05 JiLeLe05

13-01-2021

Answer:
15. Es
16. Tiene
17. Nada
18. Tiene, esta
19. Puede
20. Entran, nadan
21. Camina
22. Ve
23. Ataca, tiene
24. Escapa, esta

Answer Link

Otras preguntas

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Which M.A.D. would show the most variability: 0.5, 1, 1.5, 2

Cost of the student ticket to the school play is $7. Write an equation that correctly relates the total cost, c,

33 Triangle RST is similar to triangle RWW. 10 mm d mm 5 mm 18 mm What is the value of din millimeters? A 27 mm В 12 mm C 9 mm D 13 mm

Please Help I will Mark Branliest for first answer Please

Triangle ABC is similar to triangle WYZ. Determine whether the following statement is true or false. sin(B)>sin(Y) true false

Michael is a real estate agent who sells a house. He received $5,250 for a 3% commission on the house. How much did the house sell for?

Find the product. Simplify your answer. (2u–4)(u2+2u–1)

hi can you please help me with my work please no Link please no Link

Use the distance formula to find the distance between each PowerPoint round to the nearest 10th if necessary