RamenDonkey
RamenDonkey RamenDonkey
  • 14-04-2021
  • Biology
contestada

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Respuesta :

addysenseheult addysenseheult
  • 14-04-2021

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Answer Link

Otras preguntas

what is 40 squared approximated to the nearest tenth
In a circle with a radius of 36 3/5  cm, an arc is intercepted by a central angle of 2π/7 radians.   What is the arc length? Use 3.14 for π and round your fi
find the perimeter use 3.14
A virus is a A. hostB. producerC. consumerD. intracellular parasite
How did yellow journalists create support for the Spanish American war
Question 2(Multiple Choice Worth 5 points) (MC)Choose the correctly punctuated sentence. She cried, "Help"! She cried "Help!" She cried, "help!" She cried,
My past due bill is $585, and I just made payment arrangements for the next 3 months to keep my account from being suspended. My normal monthly bill is $50.00 p
What is the name of the quadrilateral that always has 4 right angles and 4 sides of equal length?
Complete this analogy: A timeline is to camera shots as a calendar is to years months hours in the day days of the week
Help anyone. I want to be good at math