sammycomet sammycomet

13-11-2020
Spanish

contestada

help if anyone can? I’m stuck here

help if anyone can Im stuck here class=

Respuesta :

HarryPotter10 HarryPotter10

13-11-2020

Answer:

el chico es montando

Explanation:

the boy is riding

the boy is skating = el chico es patinando

Answer Link

Dreamzen06 Dreamzen06

13-11-2020

Wish I could but I’m dumb

Answer Link

Otras preguntas

3. In the context of the text, what does it mean to be brave? How did Díaz finally confront his fears, and what was the result? Cite evidence from this text, yo

Solve the function y=-2x+3

someone help me i hate log functions

Cuál es la molaridad de una solución que se prepara disolviendo 20 mg de sulfato de sodio (Na2SO4) en agua para tener un volumen final de solución de 75 mL? Dat

Whats 416 divided by 3 with remainder

Make these fragments into sentences behind the veneer

Hong runs 4 miles in 30 minutes. At the same rate, how many miles would he run in 48 minutes?

Researchers studying populations of lizards from the genus Gallotia on the Canary Islands compared the protein cytochrome b in different populations. The table

Community center sells a total of 297 tickets Adult tickets are $3 Student tickets are $1 They collect $479 in ticket sales How many of each type of ticket we

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated