jackyjai31574 jackyjai31574

12-11-2020
Mathematics

contestada

102,918,029 Plus 16/3

Respuesta :

willysFeet willysFeet

12-11-2020

Answer:

102,918,0343.3

Step-by-step explanation:

tbh idek if this is right :|

Answer Link

angelkimble angelkimble

29-01-2021

Answer:

ahhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh hmmmmmmmmmm i think carrot

Step-by-step explanation:

Answer Link

Otras preguntas

Which measurement is most accurate to describe the weight of an adult? 1.5 tons 50 lb. 160 oz. 180 lb.

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Each serving of the fruit soda she makes. Gabi has 2/3 cup of pineapple juice and 1/2 cup of cranberry juice. How many cups of fruit soda are in 16 servings? A.

a compound-complex sentence with the word photography

Before you answer, make sure to do a step by step explanation, if you forget, it's whatever. I'll give crowns to the people that do step by step, and leave a 't

whose task is it to develop natural resources and protect our historical heritage? How?

In fort worth, texas, 6 bats ate 36 grams of insects in one night. At this rate, how many grams of insects could 42 bats eat in one night?

Help Me Please I will mark Brainliest whoever answer first and quickly

giving brainliest!! *easy*

Find the surface area of the prism.