teetee3530 teetee3530

02-03-2019
Biology

contestada

All living things are made of one or more cells. Question 4 options: True False

Respuesta :

escomil25 escomil25

02-03-2019

the answer is false..

Answer Link

skyeler05 skyeler05

02-03-2019

The answer is true, so far everything we’ve discovered is made up of cells :)

Answer Link

Otras preguntas

The function of a simile is to simply to add __________ and ___________ to objects in your work. a.dimension, understanding b.thought, emotion c.verbs, nouns d/

Please answer this guys:-(

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

please answer right ill give brainliest don't submit a wrong answer if u just want the points comment and ill help u get a lot more points just don't submit a w

what dose interwoven mean

The monthly texting plan of All Star Cell is $11 per month and $0.25 per text. The monthly texting plan of Top Line Cell is $14 per month and $0.15 per text. A

How did China use paper making, gunpowder, and printing techniques to help develop wealth and prosperity?

Which optical phenomena are formed by cloud droplets?

pick 4 simple machines and explain how they are used in your everyday life

a student completes math problems at an average rate of 2 problems every 5 minutes as this rate, how many problems does the student complete in 65 minutes?