Aniya13 Aniya13
  • 03-02-2016
  • Mathematics
contestada

How long will take you to drive 175 miles at a speed of 25 miles per hour?

Respuesta :

ahmedishaal ahmedishaal
  • 20-09-2017
speed = 25 miles per hour
distance = 175 miles
time = ?
by using the formula:
Distance = speed x time
Time = distance/ speed
Now putting the values of distance and speed we get;
time = 175/25 = 7 hours
So, it will take 7 hours to drive 175 miles at the speed of 25 miles per hour.
Answer Link

Otras preguntas

Use the galvanometers to determine the amount and direction of the induced current. Which galvanometer is indicating a current of 4 mA?
what is the pathygorean theorum? who down to ch.at?
explain hydrophobic and hydrophylic​
Determine any data values that are missing from the table, assuming that the data represent a linear function. X Y 7 16 9 17 18 13 a Miss
How do I simplify 55/35
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein
slogan against deuki system​
Why did Great Britain seek an alliance with Tecumseh’s confederacy? The British were hoping to deprive the French of any potential Native American allies. The B
What governmental system calls for a dictator, military expansion, strong control, and extreme nationalism?
How does creationism go against the teachings/indoctrination of natural selection and fitness?