mlwilbourn mlwilbourn
  • 13-03-2018
  • Chemistry
contestada

A wave with a frequency of 14 hertz has a wavelength of 3 meters. At what speed will this wave travel?

Respuesta :

Aliraza Aliraza
  • 27-03-2018
frequency = 14 Hz
wavelength = 3 m
speed = ?

speed = frequency x wavelength
speed =    14  x  3
speed =     42 meter per second

if it helps then pls give me brainliest
Answer Link

Otras preguntas

the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
4.2meters= how many centimeter
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
what might be learned from an incorrect hypothesis
Do you think then solid can undergo convection
Simplify. (-1/2)(4times)(-2)(7y)(-1) A. –28xy B. –28 C. 28xy D. 27
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5