aliciamarie3
aliciamarie3 aliciamarie3
  • 14-02-2018
  • Mathematics
contestada

witch is bigger 25ft or 8yd 11in.

Respuesta :

kaylinmendoza32
kaylinmendoza32 kaylinmendoza32
  • 14-02-2018
25 ft is bigger 8yd 11inches is 24 ft
Answer Link

Otras preguntas

What is the density of a liquid that has a volume of 20.0 ml and a mass of 330 grams?
When did the eastern part of the Roman Empire fall?
Thinking about suicide is called _________, and a suicide attempt that is not completed is called __________.
If an employee gets potentially infectious material splashed in his eye, what should he do?
what does the liver do in the excretory system
Decide if the following command is grammatically correct or incorrect. (tu) no digo mentiras.
Write the equation of the line containing the point (1 2) and parallel to the line 2x + 4y = 1
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Part 1: find the slope of the line that passes through the points (2, 1) and (2, 0). part 2: in two or more complete sentences, explain why it is not possible t
The basis of freedom of religion is found in which two principles in the bill of rights