pmbeachy3650 pmbeachy3650
  • 12-01-2018
  • English
contestada

How does nick explain the qualities of daisy's voice? how might that explain gatsby's feelings for her?

Respuesta :

williams4158 williams4158
  • 18-01-2018
He says its "full of money"
Answer Link

Otras preguntas

What property is shown by the equation? 1. 0 ÷ (–6) = 0
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
who was the founder of Pennsylvania?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for