OhDee5956 OhDee5956
  • 04-09-2017
  • Business
contestada

The process of labor is an example of a positive feedback loop, because

Respuesta :

Kalahira
Kalahira Kalahira
  • 13-09-2017
A woman going into labor demonstrates a positive feedback loop. As the baby's head pushes against the cervix, receptors in the cervix send nerve impulses through neurons (nervous cells) to the brain. These neurons send a signal to the pituitary gland (in brain) to release a hormone oxytocin. This hormone acts on the effector (muscle in the uterus) to stimulate/enhance muscle contractions. The stronger the muscle contraction, the more the head of fetus pushes on the cervix continuing the loop.
Answer Link

Otras preguntas

What are some methods used by Mussolini to rise to power?
How many combinations of 5 students can a teacher choose from 24 students? A. 5,100,480 B. 42,504 C. 7,962,624 D. 120
_______ is the largest continental biome. It experiences long, cold winters; short, mild summers; and low precipitation. It is characterized by coniferous fore
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
3+1/4x greater than 11
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
The section of the small intestine between the duodenum and ilium?
Where did middle names come from
what are 2 points on the graph for 6x-5y=25