Seudónimo Seudónimo
  • 04-05-2017
  • Health
contestada

How to stay healthy or be healthy? Tips plz

Respuesta :

lezliespruitt
lezliespruitt lezliespruitt
  • 04-05-2017
Maintain healthy eating habits
Drink more water
Sleep well every night
Excerise a lot
Answer Link
LoveRain
LoveRain LoveRain
  • 04-05-2017
Exercise, eating healthier foods and less sugary or fatty foods, and make sure you drink plenty of water.
Answer Link

Otras preguntas

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
What role does the family play in helping the youth cope with stress and depression? Help
(GIVING OUT 90 POINTS TO WHOEVER ANSWERS IN TIME!) Which of the following describes Liu Bang? A.) He was a peasant from the Han kingdom. B.) He created the Grea
0.5 divided by 0.05 plz show work
anyone know how to do this
The Gulf War was resolved when A. the United States invaded Afghanistan B. a coalition of 39 countries stopped the invasion C. Irag defeated Kuwait and made it
HELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP
Explain how revealing this information to Sharon could be considered a potential compliance concern.
Can someone do this Spanish thing for me? Thank you :) I think all you have to do is put the word in the imperfect tense. You don't have to type the whole sente
Solve this expression: 3(7m + it)