nickLonebrownk nickLonebrownk

02-05-2017
Biology

contestada

Why is a person who has Klinefelter's syndrome (XXY) a male, even though he has two X chromosomes in his cells?

Respuesta :

saturntech saturntech

02-05-2017

The Y chromosome is still present in his cells, and therefore is still male, despite the presence of two X chromosomes. The Y chromosome ultimately determines the person's sex.

Answer Link

Otras preguntas

Point) a norman window has the shape of a rectangle with a semi circle on top; diameter of the semicircle exactly matches the width of the rectangle. find the d

Find the measure of an exterior angle of a regular polygon with 20 sides. Round to the nearest tenth ?

The president, Congress members, lobbies, and even private citizens can propose legislations, but they do so in different ways. Discuss the different ways that

I need help on this question

????????????????????????

directions: write an exponential function for each situation then give the value of the function for the specified period of time.1. during the first year opera

Ellen is shopping for boxes witch attribute should she use to determine the amount the box will hold

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg

Correct installation of the dbms product is essential to any environment a. True b. False

Two numbers have a difference of 0.85 and a sum of 1 what are the numbers