munozmichelle03 munozmichelle03

12-04-2017
Mathematics

contestada

perform the indicated operation
5(3x^3)^3-2(3x^3)

Respuesta :

Аноним Аноним

12-04-2017

5(3x^3)^3-2(3x^3)
=5(3^3 x^9) - 6x^3
= 135x^9 - 6x^3
= 3x^3 (45x^6 - 2)

Answer Link

Otras preguntas

2 . 5 6 120 a. What the relationship between BEC and Z BAC? b. What the measure of ZBEC ? c. What the measure of BDC ?

What is the molarity of NaCl in which AgCl has a molar solubility of 2.38 x 10-9 mol /L? The Ksp for Silver Chloride is: 1.83 x 10-10.

The myenteric plexus is located in which layer of the alimentary canal? A. Mucous B. Serosa C. Sumucosa

metals are the best materials for making shoes. what do you think?

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

Sandra planted two seeds in her garden. Once both seeds had sprouted, she charted the growth of each plant, in inches, once every 4 days.Plant GrowthDays Plant

Which are the correct measures for WXZ, UZY, and VYX?

explain economics in your own words

I WILL GIVE BRAINLEST Jenny is a full-time college student at the local university. She is debating whether to purchase renter's insurance or not. In at least o

select the answer that correctly completes the sentence. the audience sang along with their favorite songs. A) Throughout the, musical performance, B) Throughou