Seudónimo Seudónimo
  • 03-04-2017
  • English
contestada

What's the antecedent of Don't slip and hurt yourselves?

Respuesta :

Аноним Аноним
  • 03-04-2017
If someone did what the person is going to do and got hurt they'll immediately say that warning the other to be careful.
Answer Link
jacksonelamb
jacksonelamb jacksonelamb
  • 03-04-2017
The antecedent would be "yourselves", because it's the word that you replace with a personal pronoun.
Answer Link

Otras preguntas

Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
what is the lcd of 10/11,29/44
Where did middle names come from
why is the square root of a perfect square always rational
Why did the American public mostly oppose joining the League of Nations after WWI?
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5