deanna0088 deanna0088
  • 13-09-2022
  • Mathematics
contestada

What expression is equivalent to 1/64

Respuesta :

Hwaet
Hwaet Hwaet
  • 13-09-2022

Answer:

1 ÷ 64

Step-by-step explanation:

Answer Link

Otras preguntas

What constitutes good writing for an English target language translation? a) Clarity and consistency in language usage b) Complex sentence structures c) Overuse
If two events are mutually​ exclusive, why is Upper P left parenthesis Upper A and Upper B right parenthesis equals 0​? Question content area bottom Part 1 Choo
what is globalization ​
If a nation experiences an attack, is the leadership of the impacted country obligated to strike back? 1) True 2) False
Replicate the following gene strand, and then transcribe the template strand:GTTAATGGCCATGATGGCTTTGTGATTAAGC .Translate the mRNA from above using single letter
When the BBC played an announcement 25 times a day for several weeks, listeners' memories for the announcement demonstrated that mere exposure to information di
Qual igreja da o sacramento??
List specific examples on how the EYLF is demonstrated in the service's vision and principles and how is it demonstrated in the centre?
Consider the series. Compute the 5th partial sum of s. Given that the integral test can be applied, determine the maximum error in using s₅ as an approximation.
A 80 kg car is at rest at point A. it rolls down a frictionless track and reaches the other side of the hill at position D. the system is made up of the car, tr