FreeFollow FreeFollow

15-03-2022
English

contestada

What is arithmophobia

Help ASAP

Nira here :)

Respuesta :

pedro200 pedro200

15-03-2022

Answer:

Explanation:

Miedo irracional y enfermizo a los números.

Answer Link

abemienies25 abemienies25

15-03-2022

Answer:

the fear of numbers are called arithmophobia

Answer Link

Otras preguntas

Which point below is not located in the third quadrant? A graph is given for your reference+(-10-201(-14)--12)1-3-5)72UN

If the radius of circle M is 7, and LK = 18, find JK

Calculate the PERIMETER of the figure below. Include the correct unit onyour answer. (Your answers will contain a variable.)2 points

use trigaonamets functions as nessary to find the missing parts the triangle

3x5 - 2^2 - can you help me solve this?

Add (c + 3) + ( + 6) Add and Subtract polynomials

write an inequality to represent each situation. Do not solve the inequality. define the variable 3. Leslie is driving 850 miles home from vacation. She drives

Taylor wants four different pairs of sneakers, but can only afford to buy three of thepairs? How many sets of three pairs of sneakers can she possibly choose?

can you help me please

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.