daniel22243 daniel22243

03-03-2022
English

contestada

What is the difference between low-self and high-self? How can you keep yourself engaged?

Respuesta :

duhduhs721 duhduhs721

03-03-2022

Answer:

the difference is at low self your at your lowest point and high self is when ur at ur highest point

Explanation:

at your lowest you don't feel your best at your highest point is when ur feeling better

Answer Link

Otras preguntas

Outside temperature over a day can be modelled as a sinusoidal function. Suppose you know the high temperature of 64 degrees occurs at 4 PM and the average temp

Given f (x) = 5x + 2 and g(x) = x – 3, find (fºg)(x)

Which of the following is TRUE concerning sampling errors? a. The degree of sampling error can be estimated. b. Sampling errors are frequently the most importan

The sum of two numbers is 54. One number is 26 more than the other. Find the numbers.

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Identify the prepositional phrase from this passage

A car travels for 18 minutes at an average of 72km/h. How far will the car travel in 18 minutes?

_______ fossils are of organisms known to have existed during a certain time period and are relatively abundant, assisting scientists in dating rocks and fossil

Puto el que lo lea Jajajajajajajaj >:)

George Fitzhugh stated that factory workers were treated worse than slaves.