maisonm23 maisonm23
  • 03-03-2022
  • Mathematics
contestada

4. Each team in a youth soccer league pays $784 10
consists of 12 players and the fee is divided equally
does each player pay?
Show your work
Answer

Respuesta :

jeremiahmandukic
jeremiahmandukic jeremiahmandukic
  • 03-03-2022
$784.10/12 = $65.34 (rounded)

Each player pays approximately $65.34 between all 12 players if the fee is divided equally.
Answer Link

Otras preguntas

what is information systems?​
plzz can someone tell me a little summary about el mester de juglaria in Spanish​
I need help with geometry it’s urgent. I will fail class if I don’t pass this test.
Consider the figure shown below. How long is DE?
Solve below from attached photo.
What is the complementary strand of DNA to the one below? AAACCGTATCCGCGGTATATCGCCGGAAT
How is it diagnosed?
grandir grossir rougir vieillir 1. Nous l'endroit où nous allons déjeuner. 2. Corinne quand elle a honte. 3. Mes frères cadets encore. Ils sont déjà (already) t
Fran started practicing her clarinet at 3:30 pm and finished at 5:45 pm. how long did she practice?2 hours and 30 minutes 2 hours 1 hour and 15 minutes 2 hours
For some reason, I don't understand what it's saying. Help? Tropical rain forests have the greatest biodiversity of any type of land ecosystem. How does biodive