meowsclesfnx
meowsclesfnx meowsclesfnx
  • 01-03-2022
  • Mathematics
contestada

Which situation can be represented by y = 6x?

Which situation can be represented by y 6x class=

Respuesta :

2022kreed79
2022kreed79 2022kreed79
  • 01-03-2022

Answer:

I believe it's the second one because it makes sense.

Step-by-step explanation:

I hope this helps you.

Answer Link
tbreezy21 tbreezy21
  • 01-03-2022
I think the answer c because you take x and times it by 6 to get y so you could also write 6x = y the answers is C
Answer Link

Otras preguntas

Reports from dream studies indicate that most dreams are positive. Please select the best answer from the choices provided T F
una persona de 1.75m de estatura observa un avion como se muestra en la figura, a que altura aproximada con respecto al suelo se encuentra el avion
After the hairdresser Jenny had 27 centimeters cut off her hair how many decimeters of hair did jenny have cut off
What trade agreement or union does not include the United States
PLEASE HELP !! 2. A cube-shaped aquarium has edges that are 3 ft long. The aquarium is filled with water that has a density of 62 lb/ft³. (a) Should the aquari
Please help I need good grade on this
Describe your mood board in the appropriate location of the Artist Self-Reflection Portfolio worksheet. what exactly is a mood board???
The participle inflectional morpheme ending is used only with? 6) conjunctions7) adjectives8) adverbs9) nouns0) verbs
Recognize and explain the various forms of biotechnology.
PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se