25roev05 25roev05

11-02-2022
Biology

contestada

What is the mRNA transcript if the complementary DNA is TCTGAG?

Respuesta :

10818570 10818570

11-02-2022

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

Answer Link

Otras preguntas

It takes 41 minutes for 9 people to paint 9 walls. How many minutes does it take 14 people to paint 14 walls?

The sum of two numbers is 45 and the difference is 1 .

In the largest clinical trial ever conducted, 401,974 children were randomly assigned to two groups. the treatment group consisted of 201,229 children given t

WHAT ARE NEWTON'S 3 LAW'S

According to Greg, perfect cherry pies have a ratio of 240 cherries to 3 pies. How many cherries does Greg need to make 9 perfect cherry pies?

Which of the following represents a difference between communist and democratic countries during the Cold War?

Compare the words award and warp. How are they alike? How are they different?

Are 18/23 and 108/123 equivalent? Explain

What was the Sedition Act? A) an act that made it a crime for anyone to publicly criticize the government or its officials B) an act establishing United States

Perhaps the most difficult obstacle presidents face when attempting to influence public opinion