maimelamonica388 maimelamonica388

16-01-2022
English

contestada

correct the single error in each of the following sentence.
a. Sand, surf and sun are good for the soul but their horrible for your cell phone

Respuesta :

JennyTheBest813 JennyTheBest813

16-01-2022

Answer:

Their should be they’re

Answer Link

Otras preguntas

PLEASE HELP! picture below

In 1955, Life Magazine reported that a 25-year-old mother of three worked, on average, an 80 hour week. Recently, many groups have been studying whether or not

Which number is NOT a multiple of 10? A) 2 B) 10 C) 30 D) 70

A restriction enzyme is coded for: AT!GC How long would the Base Pair fragments be for this DNA sequence? AGTCGAGTATATGCATGGCCGCGAT 1)25 and 0 2)25 and 25 3)14

Ebonie is interested in measuring levels of anxiety at the same time she provides research participants a performance task. Ebonie is more concerned about a hig

A long wire lying along the x-axis carries a current of 1.20 A in the +x direction. There is a uniform magnetic field present, given by B=0.003i + 0.004j + 0.00

Professor Murphy investigates aggression based on how an aggressor perceives information in a situation and how they make decisions about being aggressive. Prof

Consider the following reaction, equilibrium concentrations, and equilibrium constant at a particular temperature. Determine the equilibrium concentration of NO

What is 76,340 to the nearest thousand

A conductor carrying a current I = 16.5 A is directed along the positive x axis and perpendicular to a uniform magnetic field. A magnetic force per unit length