alhiamayveluz
alhiamayveluz alhiamayveluz
  • 02-12-2021
  • Arts
contestada

identify the elements and principles of arts that can be figure out from the following pictures​

identify the elements and principles of arts that can be figure out from the following pictures class=

Respuesta :

mattihoffman26
mattihoffman26 mattihoffman26
  • 02-12-2021

Answer:

Line. I’m sure we’re all aware of what lines are, but just to be sure, lines can be defined as any linear marks.

Scale. Scale is a large part of design, sometimes literally. ...

Colour. ...

Repetition. ...

Negative Space. ...

Symmetry. ...

Transparency. ...

Texture. ...

Balance. ...

Hierarchy. ...

Answer Link

Otras preguntas

What is a characteristic for Photosynthesis
Can someone please explain this?
The solution to 5 − 3x > 35 is either x > -10 or - 10 > x.
If frost in Florida reduces the quantity of vegetables sold by 20 percent and increases their retail price by 30 percent, one can conclude that: Multiple Choice
Why would an economist choose either the neoclassical perspective or the Keynesian perspective, but not both?Why would an economist choose either the neoclassic
factor completely: 21a+27
Which of the following statements is true about aquaculture? A An aquaculturist can throw some young shrimp in a pond, and they will take care of themselves. B
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
If sin A= 0.29, cos A= 0.96, sin B= 0.42, and cos B= 0.91, what is sin(A+B)? a) 0.67 b) 1.00 c) -0.14 d) 0.71
You randomly choose a marble from a jar. The jar contains 3 red marbles, 10 blue marbles, 8 green marbles, and 4 yellow marbles. Find the probability of choosin