Aminjakup Aminjakup
  • 12-09-2021
  • Mathematics
contestada

2) 67 - 21y = 25;
4) 83 + 29.x = 982.​

Respuesta :

brundag05
brundag05 brundag05
  • 12-09-2021

Answer:

2) [tex]67 - 21y = 25 \\ 21y = 25 + 67 \\ 21y = 92 \\ y = \frac{92}{21} \\ y = 4.38095238[/tex]

4) [tex]83 + 29x = 982 \\ 29x = 982 - 83 \\ 29x = 899 \\ x = \frac{899}{29} \\ x =9.08080808[/tex]

Answer Link

Otras preguntas

Thinking about suicide is called _________, and a suicide attempt that is not completed is called __________.
Asexual reproduction _____. see concept 13.1 (page 255) asexual reproduction _____. see concept 13.1 (page 255) leads to a loss of genetic material requires bo
Groups that are more formal and require less continuous interaction are known as what type of​ group?
Concerns over the Spanish treatment of what nation help lead to the Spanish–American War? A. Hawaii B. Portugal C. Canada D. Cuba
On The Magic School Bus, you find yourself traveling from Earth to the Moon. It is approximately 240 million miles. Once there, you realize you must turn 90 deg
Find the length of a leg of an isosceles right triangle whose hypotenuse measures 8√2
I'm doing C++. When i multiply 200000 by 200000, i get 1345294336. I wrote long long x = 200000 * 200000 cout << x << endl;
The basis of freedom of religion is found in which two principles in the bill of rights
Help me please im about to give up
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat