jose5415 jose5415
  • 02-09-2021
  • English
contestada

Help me please with this question

Help me please with this question class=

Respuesta :

rolandogandarajr
rolandogandarajr rolandogandarajr
  • 02-09-2021

Answer:

1. pre = un

root = break

suff = able

2. pre = pre

root = heat

suff = ing

Answer Link

Otras preguntas

Evaluate the expression 2.1 + (–3.7h) + 1.9h – 1.4
One side of the moon always faces Earth because the time it takes the moon to spin on its axis is blank the time it takes the moon to travel around Earth.
Please, someone, help me!! Please answer all questions with an explanation for each question! Thanks!!
Which is an example of deviance, but not an example of a crime?
Colin has several bottles of water. Each bottle of water holds 3 cups. During the day, he drinks 7 cups of water. How many bottles of water did Colin drink duri
the number of pounds in 9 oz
please help me with another problem
1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
name the literary device used (idiom, simile etc) "let's wrap it up" (in context of to finish something)
You push a 4.9 kg block against a horizontal spring, compressing the spring by 16 cm. then you release the block, and the spring sends it sliding across a table