yuqeys
yuqeys yuqeys
  • 13-12-2016
  • Mathematics
contestada

Can you verify my answer?

I believe it's reflection.

Can you verify my answer I believe its reflection class=

Respuesta :

Аноним Аноним
  • 13-12-2016
yes i think it is reflection try reflection
Answer Link

Otras preguntas

round 7,782 to the nearest hundred
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
solve the simultaneous equation 4x+7y=1 3x+10y=15
what is the percent change from 70 to 56?
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?
Explain why applying a vertical translation and then a horizontal translation produces the same result as applying a horizonatal translation and then a vertical
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.