jhv2qdr8dr jhv2qdr8dr

04-05-2021
Mathematics

contestada

The measurement of angle B is _____ degrees
I wanna say its 75 because it looks similar to the bottom right angle

The measurement of angle B is degrees I wanna say its 75 because it looks similar to the bottom right angle class=

Respuesta :

Аноним Аноним

04-05-2021

The Answer Is B=157°

It's corresponding to angle 157°, meaning B=157°

Answer Link

Otras preguntas

Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want

which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w

I want to work with LDAP. what is LDAP?

Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa

which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5

how do i find the angles on a kite?

how can you write 0.45 as fraction and a percentage ,please show work

What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic