angelagonzales21 angelagonzales21

14-03-2021
Mathematics

contestada

At a basketball game, a team made 56 successful shots. They were

Respuesta :

gurrolasamuel569 gurrolasamuel569

14-03-2021

56 points given to the team

Answer Link

Otras preguntas

In a paragraph, describe why the election of 1896 could be considered a turning point in American politics Be sure to consider the successes and failures of pop

What is the Domain?? Someone pls help me outtt

Compare and contrast Prokaryotic and Eukaryotic cells.

why A is not the right answer too ?

What is the complete factorization of -12 + 3x + 28? F. (x-4)(x-7) G. -(x-4)(x + 7) H. -(x + 4)(x + 7) J. -(x-7)(x + 4)

I’m bored talk to me and I’ll give you a cookie

can somebody please help me with this question

Which detail from The American Crisis develops the key idea that people have a duty to act in the present to improve society for generations to come? Question 6

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

4. During a long weekend, Devon paid a total of x dollars for a rental car so he could visit his family. He rented the care for 4 days at a rate of $36 per day.