lizbeth208 lizbeth208
  • 13-03-2021
  • Mathematics
contestada


fish swims at an altitude of -20.2 meters. A bird flies at an altitude of 38.1 meters. Which of the following statements are true? PLZ HEPPO

fish swims at an altitude of 202 meters A bird flies at an altitude of 381 meters Which of the following statements are true PLZ HEPPO class=

Respuesta :

dar5bthgki dar5bthgki
  • 23-03-2021

Answer:

D and e

Step-by-step explanation:

Answer Link

Otras preguntas

what type of desert is characterized by Cold Winters and hot summers?
If $8,500 is deposited in a compound interest account paying 3.9% interest annually, how much will be in the account after 12 years? Round your answer to the n
Emma grace types 22 words in 20 seconds. What is her rate per hour?
how did easy credit affect the postwar economy
_________________ of licensed teen drivers who use drugs regularly report they “drug and drive."
1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
Who ever gets this wright first gets a thanks :D
State two reasons Lincoln did not focus on union victory in the war.
which of the following will not be a good fuse design ? A; low-melt wire encased in glass . B; low-melt wire encased in ceramic. C; low-melt wire encased in iro
Can someone help !!!??