spirescd spirescd
  • 13-03-2021
  • Chemistry
contestada

Why do the salt compounds in the blood dissolved and chemically reacted

Respuesta :

pedrolindo pedrolindo
  • 13-03-2021

Answer:

tgrg

Explanation:

Answer Link
sparkles90 sparkles90
  • 13-03-2021
Dissolving salt in water may be written as a chemical reaction, where sodium chloride dissociates into Na+ ions and Cl– ions in water. When salt dissolves, the ionic bonds between the atoms break. The reactant (sodium chloride or NaCl) differs from the products (sodium and chloride ions), so a chemical change occurs.
Answer Link

Otras preguntas

rearrange so u Rearrange the equation so www is the independent variable. −2u+6w=9
To win a trivia game, Nevan must score 90 points. Each correct answer is worth 1 and 3/4 points, and each incorrect answer is worth −14 points. If he gets 58 q
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
Why did the black codes end?
Can you answer this:
the words predator and prey often refer to animals. When you see the word predatory, what animal comes to mind? Who might be the prey in a predatory pricing sch
Use a few sentences to explain the role light plays in our ability to see color and the role it plays in which colors we see.
which Souce energy are commonlyused in our Bhutan?​
solution of 3x(x-5)=12​
1: if Tim does not buy DEF, how many can he spend on ABC? 2: how many shares of ABC can he buy if he does not buy DEF? 3: if the selling price is $1,750, how mu