rainlust rainlust

03-03-2021
Mathematics

contestada

Which of the following number lines represents the inequality below?
X < 4

Which of the following number lines represents the inequality below X lt 4 class=

Respuesta :

CamilaGrande428 CamilaGrande428

03-03-2021

Answer:

B

Step-by-step explanation:

its B

Answer Link

Otras preguntas

(7 x 4) x 3 = 3 x (4 x 7) which property is used a) commutative b) assositative c) identity d) distributive

2) Sabendo que a montante do rio se encontra a uma cota de 230 m e a jusante do rio se encontra a uma cota de 120 m, com a vazão de 13,07 m³/s, e os rendimentos

Answer the question below

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

Go to this link, which has a journal paper for which my longtime colleague Dan Kaplan was lead author: http://www.jbc.org/content/276/47/44037.full?sid=942079f2

Kent Duncan, a sixty-four-year-old engineer, will be retiring at the end of the year. He is exploring the possibility of opening a self-service car wash. The ca

Two trains are traveling at constant speeds on different tracks. Trains Train A is traveling 12.5 meters per second. What speed is Train B traveling? meters per

Can someone help me

4(3/2 - 3x) Use the distributive property to remove the parentheses. Simplify your answer as much as possible.

Make x the subject of the formula: x/y - z = w