ballerboy1713 ballerboy1713

04-02-2021
Mathematics

contestada

Need help Its Geomety

Need help Its Geomety class=

Respuesta :

Аноним Аноним

14-02-2021

Step-by-step explanation:

Side CF is 10 due to opposite sides paralleogram theorem

FE is 15 also.

CE is 14 since it bisects it other half

GD is 11 since it half of 22.

Answer Link

Otras preguntas

as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash

how do you know 8 thousandths is less than 1 hundredths

In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn

Which of the following was not an accomplishment of the emperor Trajanlegalized Christianity built bridges, aqueducts and harbors reduced taxes

Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.

In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr

how would u form a superlative for the adverb widely

if a star is shown ti be 33.11 trillion killometers away , how many light year would that be