Seudónimo Seudónimo

02-02-2021
Chemistry

contestada

How could human activities affect natural resources like air, trees, and soil?

Respuesta :

xavierquesada xavierquesada

02-02-2021

Answer: think of the Greenhouse effect, carbon gasses in the air cause a warmer environment because there's no way for the gasses to escape Earth's atmosphere, therefore leading to polluted air, and a dirty ecosystem in our wildlife

Answer Link

Otras preguntas

Rick was so successful with his sweet treats franchise that he opened several other sweet treats locations. rick could best be described as:

which of the following statements agrees with the second law of thermodynamics

1 pts. what is one difference between primary and secondary succession? a. primary succession is rapid and secondary succession is slow. b. secondary succession

What is the value of [(2/3)^0]^-3

Which style of art is distinguished by texture oli paint ,solid forms suggested by shape imprecise lines ,and intermingled colors

Solve for x in terms of the other matrices and/or their inverses. x=b+ax

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which factor played a role in the sudden drop after 1928? A. Lack of demand B. Lack of supply C. Lack of credit D. Lack of income

great Britain is an example of a core nation True or False

What is the value of [(2/3)^0]^-3