HannahFaithLynch HannahFaithLynch
  • 14-01-2021
  • Mathematics
contestada

HELP ME PLEASE!!!!
Select the correct answer.
Solve this inequality for x: -46 − 8x > 22.
A.
x -8.5
D.
x > 8.5

Respuesta :

jimrgrant1 jimrgrant1
  • 14-01-2021

Answer:

x < - 8.5

Step-by-step explanation:

Given

- 46 - 8x > 22 ( add 46 to both sides )

- 8x > 68

Divide both sides by - 8, reversing the symbol as a result of dividing by a negative quantity

x < - [tex]\frac{68}{8}[/tex] , that is

x < - 8.5

Answer Link
cooljane cooljane
  • 14-11-2021

Answer:

x < - 8.5

I hope this helps

Answer Link

Otras preguntas

What number solves the equation x/9=4
Which of the following is the main duty of the federal court system? a. to make law b. to enforce law c. to interpret law d. to enact law
Excel computes a two‑sample confidence interval for the difference in proportions just as well and as easily as Minitab and other statistical software.A. TrueB.
What is the magnitude of the momentum of a 3400 kg airplane traveling at a speed of 400 miles per hour? (Note that you need to convert speed to meters per secon
How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10
help? pre cal, will give points
The thermal reaction of cis-(CO)4(PR3)2 + CO → Mo(CO)5(PR3) + PR3 occur most rapidly when R = ?a. PMe3b. PH3c. PEt3d. PPh3
The more mass an object has, the greater its inertia True Or False?
What is the function of the swim bladder?
On field day the first grade dash is 25 meters long. The third graders is twice the distance of the first grade dash. How long is the third grade dash??