gbarker18 gbarker18

04-01-2021
Chemistry

contestada

The known laws of chemistry and physics can explain the origin of matter.

True False

Respuesta :

ColdEggss ColdEggss

04-01-2021

Answer:

False

Explanation:

Answer Link

itsme10065 itsme10065

04-01-2021

I believe it’s false

Answer Link

Otras preguntas

Why was the leap forward created

Dash Riprock is a cost analyst with Safe Insurance Company. Safe is applying standards to its claims payment operations. Claims payment is a repetitive operatio

A few years ago, a census bureau reported that 67.4% of American families owned their homes. Census data reveal that the ownership rate in one small city is m

Find the length of YX

??????!!!!!????!!!??????

Raw materials $ 24,000 Work-in-Process 73,000 Finished goods 27,000 The company applies overhead to jobs using a predetermined overhead rate based on machine-ho

Why did the Chinese reject opening trade up with the British

For what values of x and y must the figure have in order to be parallelogram?

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’ What is the cellular process shown (mRNA to amino acids?) where in the cell does this process take place?

What are four global warming impacts?