4804144327
4804144327 4804144327
  • 03-11-2020
  • Mathematics
contestada

Who walked the furthest in 3.5 hours? Justify your answer.hanna

Respuesta :

marleykimmel
marleykimmel marleykimmel
  • 03-11-2020
what’s the full question?
Answer Link

Otras preguntas

a farmer has harvested 60% of his crops if he has harvested 72 acres , how many acres does the farmer have in all ?
Which of the following is a Pythagorean triple? A. (3,4,6) B. (5,8,10) C. (5, 12, 13) D. (1,1,2)
Study the image of ancient China’s social classes. Then use the drop-down menus to complete each sentence. Most ancient Chinese people were . Ancient China’s mi
Pleaseeeee helppppppppp
The Date Navigator is a small calendar that is displayed in the __________ Pane or in the Calendar peek that provides a quick way to display specific dates or r
can someone please help? I'm confused and I don't know the answer. ill give brainiest for the right answer. :)
Select all the sums that are positive. A. –5 + (–2) B. 5 + (–2) C. –3 + 4 D. 0 + (–3) E. –2 + 4
need mRNA AMINO ACIDS 1.AATACGGGGGCGTAACCACTA 2. GCTAGTACGTGCACATTAGAA
It takes a while for new factory workers to master a complex assembly process. During the first month that the new employees work, the company tracks the number
Retained Earnings links the Balance Sheet with which of the following important financial documents?A. Income TaxB. Free cash flow statement C. Statement of equ