i1nizam1i i1nizam1i

13-10-2020
Biology

contestada

DNA: TAC-GGC-ATA-GCA-TTT-CAC-TAA

What is the corresponding RNA sequence for the DNA strand above?

DNA TACGGCATAGCATTTCACTAA What is the corresponding RNA sequence for the DNA strand above class=

Respuesta :

13-10-2020

Answer:

Changing G to C

C to G

A to U

and T to A, the answer will be C

Answer Link

Otras preguntas

Please help guys this khan and litteraly have this unit test please guys illl mark brainliest

Cognitive psychologists are most likely to use which method of treatment with their clients?.

Which of the following is not considered a CAUSE of the Russian Revolution? Group of answer choices U.S. enters World War I due to unrestricted submarine warfar

Which of the following is not a fee that contributes to the initial cost of leasing a car? a. First payment b. Final payment c. Acquisition fee d. Disposition f

Cold air holds less water than warm air. Question 8 options: True False.

What runs along the eastern edge of the region?

need help due today please help

Mars is an 18-billion dollar privately owned business; Hershey is only a 9 billion dollar publicly owned business. How could Hershey sell more candy and chocola

Kayla works at a trampoline gym that hosts birthday parties. Parties are priced at $75 plus $12.50 per guest. Write an equation showing how the cost of a party,

Which statement would be most helpful in determining a cause of the Byzantine Empire's shrinking territory between 1020 and 1360? A. The Byzantine Empire is som