Seudónimo Seudónimo
  • 13-10-2020
  • Social Studies
contestada

giveing brainlist plzzzzzzzzzzz

giveing brainlist plzzzzzzzzzzz class=

Respuesta :

devin07johnson
devin07johnson devin07johnson
  • 13-10-2020

Answer:stone head of the Olmecs

Explanation:

Answer Link

Otras preguntas

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to d
One positive side-effect of bipolar encoding is that a bipolar violation (two consecutive pulses or two consecutive - pulses separated by any number of zeros)
What disagreements were there at Potsdam? Why?
Translate the following C++ program to MIPS assembly program #include using namespace std; const int CITY = 2; const int WEEK = 7; int main() { int temperatur
What is the range of the following set?28,45,12,34,36,45,19,20
Food chains are isolated relationships between consumers and producers and cannot intersect with each other. In other words, any given consumer can only eat one
Researchers analyzed interviews with actual child victims of sexual abuse, which revealed that the presumed child sexual abuse accommodation syndrome (CSAAS) is
When did Wallace and Darwin go on their research expedition
The following is a quote from John Locke’s Second Treatise on Government. Which founding document was most influenced by this quote? Select one: A. Articles of
Suppose a spring has a relaxed length of 28.3 cm. The simulation refers to this as the natural length. This is the length of the spring when it is not stretched