sergio9000 sergio9000
  • 12-10-2020
  • Biology
contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020
chefchinoba2020 chefchinoba2020
  • 12-10-2020
The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Answer Link

Otras preguntas

Which best state how the structures of the excerpts are similar?
What determines interactions between atoms?
^15 root x^33 simplify the radical. Assume all variables represent positive real numbers.
Describe, in detail, how people can prevent lifestyle diseases and maintain healthy habits with respect to diet, moderation of alcohol use, exercise, and the el
Margarita Island is located _____. northwest of Peru northwest of Venezuela northwest of Panama northwest of Chile
Department s had 500 units 60% completed in process at the beginning of the period; 9,000 units completed during the period; and 600 units 30% completed at the
what is meant by examples of language rights
Which finger do you use to type the following letters rtgvf
Where is the birthplace of bungee jumping?
All the organ systems in the human body work together to perform which function