drewthrelkeld7 drewthrelkeld7

16-09-2020
Spanish

contestada

Here is the fill in the blank questions. Please answer and number in order

Here is the fill in the blank questions Please answer and number in order class=

Respuesta :

denisemarr25 denisemarr25

16-09-2020

Answer:

1. está

2. está

3. estás

4. estoy

Answer Link

yazz1752 yazz1752

16-09-2020

1. Vive
2. Vivo
3. Vives
4. Vivo
5. Vives
6. Vivo

Answer Link

Otras preguntas

The interaction between two species in which both species are harmed is known as a. competition. b. predation. c. commensalism. d. parasitism. e. mutualism.

Which statement best describes the properties of ionic compounds?

northerner were satisfied / disatisified with the way the fugitive slave law was enforced because

All during class, shondra was distracted by the construction work going on outside. as a result, she couldn't remember most of the teacher's lecture. shondra's

Stanley, the skunk, is traveling from point A to point B by taking a shortcut through the pond.A path that avoids the pond is 25 feet south and 28 feet east.To

Wich of the expressions have like terms -3m+5m 2y+4x t+7.25t 14m+mn 5xy-3xy 4-8p

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg

What nickname was given to reagan's proposed spaced-based missile defense system by the media?

what is the inverse of f if f(x)=^3 sqrt x-4

Ninety-three percent of a town’s population own cars. If the number of cars owned is 5,208, what is the population of the town, if nobody owns more than 1 car?