chaajaayne chaajaayne

02-09-2020
Biology

contestada

What are the benefits of having a wide variety of plant species on Earth?

Respuesta :

Nicoright12 Nicoright12

02-09-2020

A larger number of plant species means a greater variety of crops. Greater species diversity ensures natural sustainability for all life forms. Healthy ecosystems can better withstand and recover from a variety of disasters.

Answer Link

Otras preguntas

Biggest reason why the united states did not want to enter world war 1

The hydrosphere includes _____ 2.20 unit assessment: fundamentals of ecology, part 1

Which factor played a role in the sudden drop after 1928? A. Lack of demand B. Lack of supply C. Lack of credit D. Lack of income

Can you plz help me I don’t know what alliteration I tried searching it up on google but I don’t understand

Homosociality reflects children's tendency to prefer social interactions with

The _______ was Franklin Roosevelt's program designed to fight the Great Depression

What does President Lincoln express he did not want to do?

Joan is 5 years older than ellen, and 3 years ago the sum of their ages was 17 years. in how many years will joan be 21 years old?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

what is the relationship between hitech and hipaa