dulcemolina808 dulcemolina808

01-09-2020
French

contestada

Please help me i have no idea what volla means

Please help me i have no idea what volla means class=

Respuesta :

DaniElSabiondo2 DaniElSabiondo2

01-09-2020

Answer:

Use translator :/

Explanation:

Answer Link

rtipescu rtipescu

02-09-2020

voila means “here is”

Answer Link

Otras preguntas

Why did the Bay of Pigs invasion take place, and with what results?

In which column on a check register should the total current amount in the account be entered? Deposit Transaction Balance Debit

A right triangle has a leg of 6 yards and a hypotenuse of 8 yards. What is the length of the other leg? Enter your answer, as a decimal rounded to the nearest t

Which mathematician’s collected works are by far the largest

Briefly describe the effect the Treaty of Versailles had on Europe

Read this paragraph from the article: Just last month, India's Prime Minister Narendra Modi announced his plan to connect 50 million Indian families to clean c

If there are 26 states east of the Mississippi River and 24 states west of the Mississippi River, what is the probability that the third state drawn will be eas

How did the Civil Rights Movement inspire other minority groups in U.S. society? Why did it take so long for rights guaranteed by the Constitution become realit

does anyone know how to do this

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds