wilrusty2004
wilrusty2004 wilrusty2004
  • 11-07-2020
  • Mathematics
contestada

Please help me find surface area????

Please help me find surface area class=

Respuesta :

patelchandni098 patelchandni098
  • 11-07-2020
area of square: 23 x 4 = 92 cm2
area of 1 triangle: 23 x 34)/2 = 391 cm2
area of all triangles: 391 x 4 = 1,564 cm2
area of entire prism: 92 + 1,564 = 1,656 cm2
Answer Link

Otras preguntas

In OY, shown below, the radius is 34 units, AB = 60 units, and the measure of arc AC is 71 degrees.Find each measure.​
Log_4 (8) = 3/2 in exponential form
Write this word sentence as an inequality. A number y is greater than 1 and is less than or equal to 8 .
Who is the Prime minister of India? ​
A transit train from Boston to New York and a passenger train from New York to Boston departed at the same time, at 3:00 PM. The distance between New York stati
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Casandra finds a treasure chest packed with metallic coins.The chest has a volume of 0.25 m3. The coins have a combined mass of 4825 kg. Hoping to find gold, sh
Why must operating budgets (The operating budgets include the budgets for sales, manufacturing costs (materials, labor, and overhead) or merchandise purchases,
Quick write for the Scholarship Jacket
When Sony launched its new PS4 gaming system, the product was sold as a package that included the game console, game controllers, wireless headset, and one vide